Review
Similar Products
|
RStudio
software, algorithm rstudio Software, Algorithm Rstudio, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/software, algorithm rstudio/product/RStudio Average 90 stars, based on 1 article reviews
software, algorithm rstudio - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
RStudio
software and algorithms rstudio v1.0.143 Software And Algorithms Rstudio V1.0.143, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/software and algorithms rstudio v1.0.143/product/RStudio Average 90 stars, based on 1 article reviews
software and algorithms rstudio v1.0.143 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Nikon
algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other  Algorithms Nis Elements Ar Nikon N A Prism 7 Graph Pad Software N A R Rstudio N A Alphaview Proteinsimple N A Other, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other/product/Nikon Average 99 stars, based on 1 article reviews
algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
RStudio
software, algorithm rstudio version 1.1.463 Software, Algorithm Rstudio Version 1.1.463, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/software, algorithm rstudio version 1.1.463/product/RStudio Average 90 stars, based on 1 article reviews
software, algorithm rstudio version 1.1.463 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular cell
Article Title: Targeted and Persistent 8-Oxoguanine Base Damage at Telomeres Promotes Telomere Loss and Crisis
doi: 10.1016/j.molcel.2019.04.024
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: N/A pLKO1-puro PARP1 shRNA4 (sequence:CCGGCCGAGAAATCTCTTACCTCAACTCGAGTTGAGGTAAGAGATTTCTCGGTTTTT) Sigma MISSION® shRNA SHCLNG- {"type":"entrez-nucleotide","attrs":{"text":"NM_001618","term_id":"1519246470","term_text":"NM_001618"}} NM_001618 TRCN0000007930 Clone ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_001618.2","term_id":"11496989","term_text":"NM_001618.2"}} NM_001618.2 –1176s1c1 pLKO1-puro PARP1 shRNA5 (sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTT) Sigma MISSION® shRNA SHCLNG- {"type":"entrez-nucleotide","attrs":{"text":"NM_001618","term_id":"1519246470","term_text":"NM_001618"}} NM_001618 TRCN0000007929 Clone ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_001618.2","term_id":"11496989","term_text":"NM_001618.2"}} NM_001618.2 –2715s1c1 pCMV-VSV-G Addgene, gift from Dr. Bob Weinberg Cat#8454 psPAX2 Addgene, gift from Dr. Didier Trono Cat#11260 pOGG1-EGFP plasmid Gift from Dr. Anna Campalans (CEA, France) Campalans et al., 2007 pEYFP-XRCC1 plasmid Gift from Dr. Marit Otterlei (NTNU, Normway) Fan et al., 2004 pmCherry-NEIL1 plasmid Gift from Dr. David Wilson (NIA, USA) McNeill et al., 2013 Software and
Techniques: Recombinant, Plasmid Preparation, Imaging, Clone Assay, Sequencing, shRNA, Software
Journal: eLife
Article Title: Convergent recruitment of TALE homeodomain life cycle regulators to direct sporophyte development in land plants and brown algae
doi: 10.7554/eLife.43101
Figure Lengend Snippet:
Article Snippet: Software, algorithm ,
Techniques: Software